Skip Navigation
 

Prenatal Form and Function – The Making of an Earth Suit

  
[Help]

Appendix

  Closer Look: 
  Applying the Science: 
 

Appendix A − Calculations


 

DNA Replication Rates

Given:

  1. DNA contains 3 × 109 base pairs or 6 × 109 bases distributed within an equal number of nucleotides.
  2. Mitosis occurs every 8 hours.
  3. DNA replication must be completed prior to cell division.

Step 1 - Computing the replication rate

6 × 109 nucleotides to replicate/1 cell division × 1 cell division/8 hours × 1 hour/60 minutes ×
1 minute/60 seconds = 208,333 nucleotides replicated/second



 

To the Sun and Back - Computing the Length of DNA in an Adult

Given:

  1. The DNA molecule measures 3.4 × 10-9 meters per 10 base pairs1
  2. There are 3 billion base pairs /cell.
  3. There are an estimated 100 trillion cells per adult.
  4. The distance from the earth to the sun is approximately 93 million miles.
  5. There are 2.54 inches per centimeter (cm).

Step 1 - Compute Length of DNA in a single cell

3.4 x 10-9 meters/10 base pairs × 3 x 109 base pairs/cell = 1.02 meters of DNA per cell

Step 2 - Compute total length of DNA in an adult

1.02 meters of DNA /cell × 1014 cells/adult = 1.02 × 1014 meters of DNA per adult*

Step 3 - Convert 1.02 x 1014 meters to miles

1.02 × 1014 meters × 100 cm/meter × 1inch/2.54 cm × 1 foot/12 inches × 1 mile/5,280 feet = 6.3379 x 1010 miles

Step 4 - Compute how many round trips from the earth to the sun

6.3379 × 1010 miles of DNA ÷ (93,000,000 miles/trip × 2 trips/round trip) = 340.75 =
340 round trips from
the earth to sun and back

Therefore, the DNA in a single adult, if oriented in linear fashion would exceed 63 billion miles in length. This is long enough to extend from the earth to the sun and back - 340 times

* Approximately 25 trillion red blood cells are present in the adult.2 It should be noted that red blood cells contain DNA during their maturation phase but this DNA degenerates and is not present in the mature form. This calculation includes the DNA from red blood cells.




 

A Tight Squeeze: Appreciating the Number of Bases Contained in the DNA of a Single Cell

The following page contains a list of 3,808 capital letters each of which represents a single base.

Given:

  1. A, G, T, and C each represent a base within the DNA of a single cell
  2. Each line contains 68 letters without spaces representing 68 bases.
  3. Each page contains 56 lines. (Page size: 8½ × 11 inches, font size: 10, spaces between letters: none, lines: single spaced, margins: standard)
  4. Each cell contains 3 billion base pairs equaling 6 billion bases.

The calculation of the number of pages required to list all DNA bases in a single cell is as follows:

68 bases/line × 56 lines/page = 3,808 bases/page
6,000,000,000 bases/cell ÷ 3,808 bases/page = 1,575,630 pages/cell

ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG



 

Climate Control: Approximating the Normal Range of Embryonic and Fetal Body Temperature

Given:

  1. The placenta maintains fetal temperature between 0.5 ºC and 1.5 ºC above maternal core temperature.3
  2. Maternal core temperature is 99.6º Fahrenheit
  3. The formula to convert temperature from Fahrenheit (ºF) to Celsius (ºC) is ºC = 5/9 (ºF - 32)

The calculation to compute the range of embryonic/fetal body temperature is as follows:

Step 1 - Convert maternal core temperature from Fahrenheit to Celsius

Substituting using: ºC = 5/9 (ºF - 32)

Maternal core temperature in ºC = 5/9 (99.6 - 32) = 37.56 ºC

Step 2 - Compute lower and upper ranges of fetal body temperature in Celsius

Lower range (Celsius) = maternal core temperature + 0.5 ºC = 37.56 + 0.5 = 38.2 ºC

Upper Range (Celsius) = maternal core temperature + 1.5 ºC = 37.56 + 1.5 = 39.2 ºC

Step 3 - Convert Results to Fahrenheit

ºC = 5/9 (ºF - 32) 9/5ºC = (ºF - 32) ºF = 9/5 ºC + 32

Substituting to Find the Lower Limit of Fetal Body Temperature
ºF = 9/5 ºC + 32 ºF = 9/5 (38.16) + 32 ºF = 100.7º

Substituting to Find the Upper Limit of Fetal Body Temperature
ºF = 9/5 ºC + 32 ºF = 9/5 (39.16) + 32 ºF = 102.5º

Summary of Normal Fetal Body Temperature Range
  °F °C
Upper Limit 100.7 38.2
Lower Limit 102.5 39.2


 

The Beat Goes On – Tracking the Total Number of Heart Beats During Pregnancy and Beyond

Estimating the Number of Heart Beats Before Birtha

Week # Average Heart Rate
(Beats per Minute)
Beats per Week Running Total
4 113.00 1,139,040 1,139,040
5 132.00 1,330,560 2,469,600
6 151.00 1,522,080 3,991,680
7 170.00 1,713,600 5,705,280
8 169.03 1,703,845 7,409,125
(Approximately 7.41 million beats during the embryonic period)

Various authors agree the heart rate peaks at 7 weeks. Reported heart rates vary however. Van Heeswijk et al. report a peak heart rate of 167 ± 8 beats per minute (bpm)4 while Leeuwen et al. report a peak rate of 175 bpm.5 Van Lith et al. report the median fetal heart rate peaks at 177 bpm at 7 weeks.6 One hundred seventy (170) bpm has been chosen as the peak heart rate for illustration purposes in this calculation. The heart rate for the various weeks from 7 through 38 have been calculated via linear interpolations7 assuming heart rates of 170 bpm at 7 weeks and 140 bpm at term or 38 weeks.8

(Note: Heart rates are estimated. Living conditions and individual experience can and will vary.)

Fetal Period
Week # Average Heart Rate
(Beats per Minute)
Beats per Week Running Total
9 168.06 1,694,090 9,103,216
10 167.10 1,684,336 10,787,551
11 166.13 1,674,581 12,462,132
12 165.16 1,664,826 14,126,958
13 164.19 1,655,071 15,782,029
14 163.23 1,645,316 17,427,346
15 162.26 1,635,562 19,062,907
16 161.29 1,625,807 20,688,714
17 160.32 1,616,052 22,304,766
18 159.35 1,606,297 23,911,063
19 158.39 1,596,542 25,507,605
20 157.42 1,586,787 27,094,393
21 156.45 1,577,033 28,671,425
22 155.48 1,567,278 30,238,703
23 154.52 1,557,523 31,796,226
24 153.55 1,547,768 33,343,994
25 152.58 1,538,013 34,882,008
26 151.61 1,528,259 36,410,266
27 150.65 1,518,504 37,928,770
28 149.68 1,508,749 39,437,519
29 148.71 1,498,994 40,936,513
30 147.74 1,489,239 42,425,752
31 146.77 1,479,484 43,905,237
32 145.81 1,469,730 45,374,966
33 144.84 1,459,975 46,834,941
34 143.87 1,450,220 48,285,161
35 142.90 1,440,465 49,725,626
36 141.94 1,430,710 51,156,337
37 140.97 1,420,956 52,577,292
38 140.00 1,411,201 53,988,493
(Approximately 54 million beats before birth)
Counting the Beats of Life
The Postnatal Period from Birth to 80 Years
Year # Average Heart Rate
(Beats per Minute)9
Beats per Year Running Total
1 120 63,115,200 63,115,200
2 110 57,855,600 120,970,800
3 103 54,173,880 175,144,680
4 103 54,173,880 229,318,560
5 103 54,173,880 283,492,440
6 103 54,173,880 337,666,320
7 95 49,966,200 387,632,520
8 95 49,966,200 437,598,720
9 95 49,966,200 487,564,920
10 95 49,966,200 537,531,120
11 85 44,706,600 582,237,720
12 85 44,706,600 626,944,320
13 85 44,706,600 671,650,920
14 85 44,706,600 716,357,520
15 80 42,076,800 758,434,320
16 80 42,076,800 800,511,120
17 75 39,447,000 839,958,120
18 75 39,447,000 879,405,120
19 70 36,817,200 916,222,320
20 70 36,817,200 953,039,520
21-80 70 2,209,032,000 3,162,071,520
(Approximately 3.16 billion beats from birth to age 80 years)
Estimated Total Heart Beats From the
3-Week Embryo to Age 80 Years
3,216,060,000
(Approximately 3.2 Billion Beats Per Lifetime)



 

Appendix B − Relating Embryonic Age & Stage

O'Rahilly and Müller's Age Assignments vs. Carnegie Stages, 1987 to 2001

Carnegie
Stage
Number
of Somites
Greatest
Length (mm)
1987 Age 10
Convention
(in PF Days*)
1999 Age 11
Convention
(in PF Days*)
2001 Age 12
Convention
(in PF Days*)
1   0.1 - 0.15 1 - 1
2   0.1 - 0.2 1½ - 3 2 - 3 2 - 3
3   0.1 - 0.2 4 4 - 5 4 - 5
4   0.1 - 0.2 5 - 6 6 6
5   0.1 - 0.2 7 - 12 7 - 12 -
5a   0.1 7 - 8 - 7 - 8
5b   0.1 9 - 9
5c   0.15 - 0.2 11 - 12 - 11 - 12
6   0.2 13 17 17
6a   - - - -
6b   - - - -
7   0.4 16 19 19
8   1.0 - 1.5 18 23 -
8a   - - - 23
8b   - - - 23
9 1-3 1.5 - 2.5 20 26 25
10 4-12 2 - 3.5 22 29 28
11 13-20 2.5 - 4.5 24 30 29
12 21-29 3 - 5 26 31 30
13 30+ 4 - 6 28 32 32
14   5 - 7 32 33 33
15   7 - 9 33 35 36
16   8 - 11 37 37 38
17   11 - 14 41 40 41
18   13 - 17 44 42 44
19   16 - 18 47½  44 46
20   18 - 22 50½  47 49
21   22 - 24 52 50 51
22   23 - 28 54 52 53
23   27 - 31 56½  56 56

* PF Days = Postfertilization Days

There is international agreement among embryologists that human development during the embryonic period be divided into 23 stages which were initially proposed by Mall, described by Streeter, and amended by O'Rahilly and Müller in 1987.13 These have come to be known as Carnegie Stages. Particular internal and external features are required for inclusion in any given embryonic stage. These stages are independent of age and length and the use of the term 'stage' should be reserved for reference to this system per O'Rahilly and Müller in multiple publications.

Along with nearly-universal acceptance of the human embryonic staging system, a variety of age assignments have been proposed for each embryonic stage. Streeter believed the embryonic period spanned a 47- to 48- day period instead of the 56-day period accepted today. The Endowment for Human Development adopts the convention set forth by O'Rahilly and Müller in 1987 which has received widespread, but not universal, acceptance. O'Rahilly and Müller have since proposed amending this convention in light of transvaginal ultrasound data through a personal communication with Dr. Josef Wisser in 1992.14 These alternate proposals are provided for the interested reader.

For instance, the onset of embryonic cardiac contraction (onset of the heartbeat) has long been described as a Carnegie Stage 10 or possibly a late Stage 9 event.15 We report this event occurring at an age of 3 weeks, 1 day (22 days) postfertilization using the 1987 convention. Others may report this occurrence at 28 or 29 days as shown above. Of interest is a paper by Wisser and Dirschedl who reported using transvaginal ultrasound to visualize the embryonic heartbeat 23 days postfertilization in two embryos fertilized in vitro "with exactly known … age" and "in embryos from 2 mm of greatest length onwards."16 This finding most closely coincides with the 1987 age convention. Schats et al. reported the earliest cardiac activity at 25 days after follicle aspiration in embryos conceived in vitro.17 Tezuka et al. reported the earliest cardiac activity at 23 days postfertilization in embryos conceived naturally.18

There is considerable variation in normal human development during the postnatal period. The prenatal period is no different with variations in the size, rate of growth, and order of appearance of some structures or functions. No one knows the exact age range for each stage with absolute certainty. These approximations may change in the future as additional knowledge is gained through careful, published research.

back to top
Intro
The First
Week
1 to 2
Weeks
2 to 3
Weeks
3 to 4
Weeks
4 to 5
Weeks
5 to 6
Weeks
6 to 7
Weeks
7 to 8
Weeks
8 to 9
Weeks
9 to 10
Weeks
10 to 11
Weeks
11 to 12
Weeks
3 to 4
Months
4 to 5
Months
5 to 6
Months
6 to 7
Months
7 to 8
Months
8 to 9
Months
9 Months
to Birth
Appendix
Sources
Footnotes

1 Lodish et al., 2000, 104.
2 Guyton and Hall, 2000, 2.
3 Liley, 1972, 101.
4 van Heeswijk et al., 1990, 153.
5 Leeuwen et al., 1999, 265.
6 van Lith et al., 1992, 741.
7See Appendix A.
8 DiPietro et al., 1996, 2559.
9 Bates, 1987, 541.
10 O'Rahilly and Müller, 1987, 3.
11 O'Rahilly and Müller, 1999a, Various pages.
12 O'Rahilly and Müller, 2001, 490.
13 O'Rahilly and Müller, 2001, 3.
14 O'Rahilly and Müller, 1999a, 13.
15 Campbell, 2004, 14; Carlson, 2004, 430; de Vries and Saunders, 1962, 96; Gardner and O'Rahilly, 1976, 583; Gilbert-Barness and Debich-Spicer, 1997, 650; Gittenger-de Groot et al., 2000, 17; van Heeswijk et al., 1990, 151; Kurjak and Kos, 1994, 439; Navaratnam, 1991, 147-148; O'Rahilly and Müller, 1987, 99; Wisser and Dirschedl, 1994, 108.
16 Wisser and Dirschedl, 1994, 108.
17 Schats et al., 1990, 989.
18 Tezuka et al., 1991, 211.